Github-comments August 2024

github-comments@lists.geany.org

1 participants
45 discussions

[geany/geany] Build failure on macOS: `error: conflicting types for 'scandir'; have 'int(const char *, struct dirent ***, int (*)(const struct dirent *), int (*)(const struct dirent **, const struct dirent **))'` (Issue #3935)
by Sergey Fedorov 16 Aug '24

16 Aug '24

``` /bin/sh ../libtool --silent --tag=CC --mode=compile ccache /opt/local/bin/gcc-mp-14 -DHAVE_CONFIG_H -I. -I.. -I./main -I./parsers -I./dsl -DEXTERNAL_PARSER_LIST_FILE=\"../src/tagmanager/tm_parsers.h\" -DG_LOG_DOMAIN=\"CTags\" -I/opt/local/include -I/opt/local/include/gtk-3.0 -I/opt/local/include/at-spi2-atk/2.0 -I/opt/local/include/at-spi-2.0 -I/opt/local/include/dbus-1.0 -I/opt/local/lib/dbus-1.0/include -I/opt/local/include/gtk-3.0 -I/opt/local/include/gio-unix-2.0 -I/opt/local/include/cairo -I/opt/local/include/pango-1.0 -I/opt/local/include/harfbuzz -I/opt/local/include/pango-1.0 -I/opt/local/include/fribidi -I/opt/local/include/harfbuzz -I/opt/local/include/atk-1.0 -I/opt/local/include/cairo -I/opt/local/include/pixman-1 -I/opt/local/include/freetype2 -I/opt/local/include/gdk-pixbuf-2.0 -I/opt/local/include/libpng16 -I/opt/local/include/glib-2.0 -I/opt/local/lib/glib-2.0/include -DGLIB_VERSION_MIN_REQUIRED=GLIB_VERSION_2_32 -DGDK_DISABLE_DEPRECATION_WARNINGS -fvisibility=hidden -DGEANY_EXPORT_SYMBOL="__attribute__((visibility(\"default\")))" -DGEANY_API_SYMBOL=GEANY_EXPORT_SYMBOL -pipe -Os -arch ppc -MT main/portable-scandir.lo -MD -MP -MF $depbase.Tpo -c -o main/portable-scandir.lo main/portable-scandir.c &&\ mv -f $depbase.Tpo $depbase.Plo depbase=`echo main/promise.lo | sed 's|[^/]*$|.deps/&|;s|\.lo$||'`;\ /bin/sh ../libtool --silent --tag=CC --mode=compile ccache /opt/local/bin/gcc-mp-14 -DHAVE_CONFIG_H -I. -I.. -I./main -I./parsers -I./dsl -DEXTERNAL_PARSER_LIST_FILE=\"../src/tagmanager/tm_parsers.h\" -DG_LOG_DOMAIN=\"CTags\" -I/opt/local/include -I/opt/local/include/gtk-3.0 -I/opt/local/include/at-spi2-atk/2.0 -I/opt/local/include/at-spi-2.0 -I/opt/local/include/dbus-1.0 -I/opt/local/lib/dbus-1.0/include -I/opt/local/include/gtk-3.0 -I/opt/local/include/gio-unix-2.0 -I/opt/local/include/cairo -I/opt/local/include/pango-1.0 -I/opt/local/include/harfbuzz -I/opt/local/include/pango-1.0 -I/opt/local/include/fribidi -I/opt/local/include/harfbuzz -I/opt/local/include/atk-1.0 -I/opt/local/include/cairo -I/opt/local/include/pixman-1 -I/opt/local/include/freetype2 -I/opt/local/include/gdk-pixbuf-2.0 -I/opt/local/include/libpng16 -I/opt/local/include/glib-2.0 -I/opt/local/lib/glib-2.0/include -DGLIB_VERSION_MIN_REQUIRED=GLIB_VERSION_2_32 -DGDK_DISABLE_DEPRECATION_WARNINGS -fvisibility=hidden -DGEANY_EXPORT_SYMBOL="__attribute__((visibility(\"default\")))" -DGEANY_API_SYMBOL=GEANY_EXPORT_SYMBOL -pipe -Os -arch ppc -MT main/promise.lo -MD -MP -MF $depbase.Tpo -c -o main/promise.lo main/promise.c &&\ mv -f $depbase.Tpo $depbase.Plo depbase=`echo main/ptag.lo | sed 's|[^/]*$|.deps/&|;s|\.lo$||'`;\ /bin/sh ../libtool --silent --tag=CC --mode=compile ccache /opt/local/bin/gcc-mp-14 -DHAVE_CONFIG_H -I. -I.. -I./main -I./parsers -I./dsl -DEXTERNAL_PARSER_LIST_FILE=\"../src/tagmanager/tm_parsers.h\" -DG_LOG_DOMAIN=\"CTags\" -I/opt/local/include -I/opt/local/include/gtk-3.0 -I/opt/local/include/at-spi2-atk/2.0 -I/opt/local/include/at-spi-2.0 -I/opt/local/include/dbus-1.0 -I/opt/local/lib/dbus-1.0/include -I/opt/local/include/gtk-3.0 -I/opt/local/include/gio-unix-2.0 -I/opt/local/include/cairo -I/opt/local/include/pango-1.0 -I/opt/local/include/harfbuzz -I/opt/local/include/pango-1.0 -I/opt/local/include/fribidi -I/opt/local/include/harfbuzz -I/opt/local/include/atk-1.0 -I/opt/local/include/cairo -I/opt/local/include/pixman-1 -I/opt/local/include/freetype2 -I/opt/local/include/gdk-pixbuf-2.0 -I/opt/local/include/libpng16 -I/opt/local/include/glib-2.0 -I/opt/local/lib/glib-2.0/include -DGLIB_VERSION_MIN_REQUIRED=GLIB_VERSION_2_32 -DGDK_DISABLE_DEPRECATION_WARNINGS -fvisibility=hidden -DGEANY_EXPORT_SYMBOL="__attribute__((visibility(\"default\")))" -DGEANY_API_SYMBOL=GEANY_EXPORT_SYMBOL -pipe -Os -arch ppc -MT main/ptag.lo -MD -MP -MF $depbase.Tpo -c -o main/ptag.lo main/ptag.c &&\ mv -f $depbase.Tpo $depbase.Plo main/portable-scandir.c:136:1: error: conflicting types for 'scandir'; have 'int(const char *, struct dirent ***, int (*)(const struct dirent *), int (*)(const struct dirent **, const struct dirent **))' 136 | scandir(const char *directory_name, | ^~~~~~~ In file included from main/portable-dirent_p.h:5, from main/routines_p.h:17, from main/portable-scandir.c:112: /usr/include/dirent.h:118:5: note: previous declaration of 'scandir' with type 'int(const char *, struct dirent ***, int (*)(struct dirent *), int (*)(const void *, const void *))' 118 | int scandir(const char *, struct dirent ***, | ^~~~~~~ make[2]: *** [main/portable-scandir.lo] Error 1 make[2]: *** Waiting for unfinished jobs.... make[2]: Leaving directory `/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_macports_release_tarballs_ports_devel_geany/geany/work/geany-2.0/ctags' make[1]: *** [all-recursive] Error 1 make[1]: Leaving directory `/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_macports_release_tarballs_ports_devel_geany/geany/work/geany-2.0' make: *** [all] Error 2 ``` -- Reply to this email directly or view it on GitHub: https://github.com/geany/geany/issues/3935 You are receiving this because you are subscribed to this thread. Message ID: <geany/geany/issues/3935(a)github.com>

1 0

[geany/geany] Update Portuguese translation (PR #3933)
by Hugo Carvalho 15 Aug '24

15 Aug '24

Update pt.po file You can view, comment on, or merge this pull request online at: https://github.com/geany/geany/pull/3933 -- Commit Summary -- * Update Portuguese translation -- File Changes -- M po/pt.po (2143) -- Patch Links -- https://github.com/geany/geany/pull/3933.patch https://github.com/geany/geany/pull/3933.diff -- Reply to this email directly or view it on GitHub: https://github.com/geany/geany/pull/3933 You are receiving this because you are subscribed to this thread. Message ID: <geany/geany/pull/3933(a)github.com>

2 1

[geany/geany] TOML configuration language support (#1268)
by grinapo 15 Aug '24

15 Aug '24

TOML is a fairly strictly defined configuration file syntax, used by various projects, supported by plenty of languages and already supported by some editors. I'm not familar with geany plugin dev (and lacking the time anyway) but maybe someone's interested in creating a syntax highlighting ruleset, similar to the INI config format. https://github.com/toml-lang/toml -- You are receiving this because you are subscribed to this thread. Reply to this email directly or view it on GitHub: https://github.com/geany/geany/issues/1268

5 10

[geany/geany-plugins] [WishList] projectorganizer commander like interface (#599)
by Sagar Chalise 15 Aug '24

15 Aug '24

I think it would make sense to give commander like search as you type interface for project organizer related `find file` and `find tags`. Say you show an entry box and as you type show the related list of objects and open file/with tags on `enter` -- You are receiving this because you are subscribed to this thread. Reply to this email directly or view it on GitHub: https://github.com/geany/geany-plugins/issues/599

2 2

[geany/geany] Support for Microsoft Language Server Protocol? (#1854)
by Denis Feklushkin 12 Aug '24

12 Aug '24

It is possible to add it? -- You are receiving this because you are subscribed to this thread. Reply to this email directly or view it on GitHub: https://github.com/geany/geany/issues/1854

5 30

Re: [geany/geany] Go to a Symbol by typing name (#497)
by Jiří Techet 12 Aug '24

12 Aug '24

This was implemented by https://github.com/geany/geany-plugins/pull/1341 in the ProjectOrganizer plugin and is also present in the LSP plugin. -- Reply to this email directly or view it on GitHub: https://github.com/geany/geany/issues/497#issuecomment-2283826354 You are receiving this because you are subscribed to this thread. Message ID: <geany/geany/issues/497/2283826354(a)github.com>

1 0

Re: [geany/geany] Go to a Symbol by typing name (#497)
by Jiří Techet 12 Aug '24

12 Aug '24

Closed #497 as completed. -- Reply to this email directly or view it on GitHub: https://github.com/geany/geany/issues/497#event-13847723363 You are receiving this because you are subscribed to this thread. Message ID: <geany/geany/issue/497/issue_event/13847723363(a)github.com>

1 0

[geany/geany] [Feature Request] Provide auto completion for Swift Language. (#1078)
by rahul1994joshi 12 Aug '24

12 Aug '24

Please add the support for the swift language auto completion functionality . --- You are receiving this because you are subscribed to this thread. Reply to this email directly or view it on GitHub: https://github.com/geany/geany/issues/1078

6 6

[geany/geany] error running geany at terminal as regular user (Issue #3931)
by TheMCMan 12 Aug '24

12 Aug '24

every time i want to run geany as a user in terminal it errors unill i kill all at-spi processes running under root... ps aux | grep at-spi -- Reply to this email directly or view it on GitHub: https://github.com/geany/geany/issues/3931 You are receiving this because you are subscribed to this thread. Message ID: <geany/geany/issues/3931(a)github.com>

2 5

[geany/geany] Search is broken when same strings of text overlap (Issue #3932)
by osowiecki 12 Aug '24

12 Aug '24

Issue Search for "AGTCCCTCAAG" in Geany. It will fail to find "AGTCCCTCAAG" in "AGTCCCTCAAGTCCCTCAAG". This is also broken in latest Firefox... Steps to reproduce Textfile : Substring: 'AGTCCCTCAAG (forward) (length: 11)' Occurs 2 times forward in the target sequence Forward occurrence in reference sequence: 1 Reversed occurrence in reference sequence: 0 Total occurrences in reference sequence: 1 Unmasked target sequence: AGTCCCTCAAGTCCCTCAAGCCGCCACCGCCGCC Unmasked target sequence: AGTCCCTCA AGTCCCTCAAGCCGCCACCGCCGCC Masked target sequence: ***********TCCCTCAAGCCGCCACCGCCGCC Unmasked reference sequence: AGTCCCTCAAGT Masked reference sequence: ***********T Expected behaviour Finds "AGTCCCTCAAG" twice -- Reply to this email directly or view it on GitHub: https://github.com/geany/geany/issues/3932 You are receiving this because you are subscribed to this thread. Message ID: <geany/geany/issues/3932(a)github.com>

2 2

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

Github-comments August 2024