I wanted to build a minimal syntax highlighting for fasta files. Such files are used commonly in biology/bioinformatics and may look like this:
```
Description of first element
TAGCGACTACGACTACGATCAGCATCTACGAT
Description of second element
TGAGCTACGACGTGAGCGGGGAGCGGCGCCTAG ```
I wanted to highlight the description lines and thought that marking it as "comment" should work. However, it looks like it is not possible to use `>` as character for a comment.
/home/myuser/.config/geany/filedefs/filetypes.Fasta.conf: ``` [styling=Conf]
[settings] lexer_filetype=Conf extension=fasta
comment_single=> ```
The `filetype_extensions.conf` was adjusted accordingly and the *.fasta files are recognized as Fasta files according to the menu `Document` -> `Set filetype`
This does not work as intended. Lines starting with `#` or `;` are highlighted as comments, but lines starting with `>` are not.
Did I do anything wrong? Could you please help me with this (seemingly simple) issue?