I wanted to build a minimal syntax highlighting for fasta files. Such files are used commonly in biology/bioinformatics and may look like this:

>Description of first element
TAGCGACTACGACTACGATCAGCATCTACGAT

>Description of second element
TGAGCTACGACGTGAGCGGGGAGCGGCGCCTAG

I wanted to highlight the description lines and thought that marking it as "comment" should work. However, it looks like it is not possible to use > as character for a comment.

/home/myuser/.config/geany/filedefs/filetypes.Fasta.conf:

[styling=Conf]

[settings]
lexer_filetype=Conf
extension=fasta

comment_single=>

The filetype_extensions.conf was adjusted accordingly and the *.fasta files are recognized as Fasta files according to the menu Document -> Set filetype

This does not work as intended. Lines starting with # or ; are highlighted as comments, but lines starting with > are not.

Did I do anything wrong? Could you please help me with this (seemingly simple) issue?

—
You are receiving this because you are subscribed to this thread.
Reply to this email directly, view it on GitHub, or mute the thread.