If a UTF-8 file starts with a BOM character, the changebar plugin always shows the first line as changed even if there is no change.
To reproduce this, create a file with some lines of text, set encoding to UTF-8 and set "Document -> Write Unicode BOM"; save the file and git add and commit. The changebar immediately (or when reloading the file) shows the first line as changed.
Geany 1.27 on Linux (ubuntu 16.04)
--
You are receiving this because you are subscribed to this thread.
Reply to this email directly or view it on GitHub:
https://github.com/geany/geany-plugins/issues/482
I like the Make custom target Shift-F9
I would like to have a variable %t to be able to put the custom part where i want in the command.
Exemple :
git commit -m "%t" "%f" ; git push
Will open the dialogue box (that retains last text) i will enter "New Sexy version" and it will spwan the shell commande
git commit -m "New Sexy version" awesome.py ; git push
Geany Is the best Editor around
--
You are receiving this because you are subscribed to this thread.
Reply to this email directly or view it on GitHub:
https://github.com/geany/geany/issues/1243
I wanted to build a minimal syntax highlighting for fasta files. Such files are used commonly in biology/bioinformatics and may look like this:
```
>Description of first element
TAGCGACTACGACTACGATCAGCATCTACGAT
>Description of second element
TGAGCTACGACGTGAGCGGGGAGCGGCGCCTAG
```
I wanted to highlight the description lines and thought that marking it as "comment" should work. However, it looks like it is not possible to use `>` as character for a comment.
/home/myuser/.config/geany/filedefs/filetypes.Fasta.conf:
```
[styling=Conf]
[settings]
lexer_filetype=Conf
extension=fasta
comment_single=>
```
The `filetype_extensions.conf` was adjusted accordingly and the *.fasta files are recognized as Fasta files according to the menu `Document` -> `Set filetype`
This does not work as intended. Lines starting with `#` or `;` are highlighted as comments, but lines starting with `>` are not.
Did I do anything wrong? Could you please help me with this (seemingly simple) issue?
--
You are receiving this because you are subscribed to this thread.
Reply to this email directly or view it on GitHub:
https://github.com/geany/geany/issues/1240
For example `geany_plugin_register_full()` could register the module-bound data and we could add a `GData*` list to the `GeanyPlugin` for activation-bound arbitrary data (similar to document-data).
--
You are receiving this because you are subscribed to this thread.
Reply to this email directly or view it on GitHub:
https://github.com/geany/geany/commit/437837d3a54367393c41d6c1e1f4d1af44816…
The data is destroyed depending on whether it was set at load (free at unload) or init (free at cleanup). See LOAD_DATA flag. This is also documented this way.
--
You are receiving this because you are subscribed to this thread.
Reply to this email directly or view it on GitHub:
https://github.com/geany/geany/commit/437837d3a54367393c41d6c1e1f4d1af44816…